Journal: Indian Journal of Microbiology

Article Title: Factors Affecting Inducible Expression of Outer Membrane Protein A (OmpA) of Shigella dysenteriae Type-1 in Lactococcus lactis Using Nisin Inducible Controlled Expression (NICE)

doi: 10.1007/s12088-015-0556-2

Figure Lengend Snippet: Expression cassette for outer membrane protein A (OmpA) using the nisin inducible promoter (PnisA) and signal peptide usp45. a OmpA sequence of S. dysenteriae type-1 was commercially synthesized from GenScript in pUC57 cloning vector between NsiI and EcoRV RE sites. b pSEC:Nuc vector which has a combination of NICE system and usp45 secretory signal was used as a backbone vector. c OmpA gene was cloned in place of nuc gene by using NsiI and EcoRV RE sites and ligating the digested products. Arrows indicate presence of nisin inducible promoter PnisA. Gray box indicate presence of signal peptide of usp45 gene. Small empty box structure indicates trpA transcriptional terminator

Article Snippet: Transformants were screened by colony PCR using ompA specific primers (Forward 5′ GTTTCCTACCGTTTCGGTC 3′ and reverse 5′ TGCGCACTGAGAAGAAGAGA 3′) and verified by restriction sequence analyses. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Fig. 1 caption a7 Expression cassette for outer membrane protein A (OmpA) using the nisin inducible promoter (PnisA) and signal peptide usp45. a OmpA sequence of S. dysenteriae type-1 was commercially synthesized from GenScript in pUC57 cloning vector between Nsi I and EcoR V RE sites. b pSEC:Nuc vector which has a combination of NICE system and usp45 secretory signal was used as a backbone vector. c OmpA gene was cloned in place of nuc gene by using Nsi I and EcoR V RE sites and ligating the digested products.

Techniques: Expressing, Membrane, Sequencing, Synthesized, Cloning, Plasmid Preparation, Clone Assay

Journal: Indian Journal of Microbiology

Article Title: Factors Affecting Inducible Expression of Outer Membrane Protein A (OmpA) of Shigella dysenteriae Type-1 in Lactococcus lactis Using Nisin Inducible Controlled Expression (NICE)

doi: 10.1007/s12088-015-0556-2

Figure Lengend Snippet: Strains and plasmids used in the study

Article Snippet: Transformants were screened by colony PCR using ompA specific primers (Forward 5′ GTTTCCTACCGTTTCGGTC 3′ and reverse 5′ TGCGCACTGAGAAGAAGAGA 3′) and verified by restriction sequence analyses. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Fig. 1 caption a7 Expression cassette for outer membrane protein A (OmpA) using the nisin inducible promoter (PnisA) and signal peptide usp45. a OmpA sequence of S. dysenteriae type-1 was commercially synthesized from GenScript in pUC57 cloning vector between Nsi I and EcoR V RE sites. b pSEC:Nuc vector which has a combination of NICE system and usp45 secretory signal was used as a backbone vector. c OmpA gene was cloned in place of nuc gene by using Nsi I and EcoR V RE sites and ligating the digested products.

Techniques: Plasmid Preparation, Mutagenesis, Synthesized

Journal: Indian Journal of Microbiology

Article Title: Factors Affecting Inducible Expression of Outer Membrane Protein A (OmpA) of Shigella dysenteriae Type-1 in Lactococcus lactis Using Nisin Inducible Controlled Expression (NICE)

doi: 10.1007/s12088-015-0556-2

Figure Lengend Snippet: Expression of OmpA at different nisin (inducer) concentration. Lane M-a Precision plus protein standard, BIORAD, Lane-1 r-NZ9000 (pSEC:OmpA) induced with 15 ng/mL, Lane-M-b Pre-stained protein ladder, Thermo Scientific, Lane-2 Empty, Lane-3 r-NZ9000 (pSEC:OmpA) induced with 2 ng/mL, Lane-4 r-NZ9000 (pSEC:OmpA) induced with 10 ng/mL, Lane-M-c ProSieve Color Protein Marker, Lonza Rockland

Article Snippet: Transformants were screened by colony PCR using ompA specific primers (Forward 5′ GTTTCCTACCGTTTCGGTC 3′ and reverse 5′ TGCGCACTGAGAAGAAGAGA 3′) and verified by restriction sequence analyses. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Fig. 1 caption a7 Expression cassette for outer membrane protein A (OmpA) using the nisin inducible promoter (PnisA) and signal peptide usp45. a OmpA sequence of S. dysenteriae type-1 was commercially synthesized from GenScript in pUC57 cloning vector between Nsi I and EcoR V RE sites. b pSEC:Nuc vector which has a combination of NICE system and usp45 secretory signal was used as a backbone vector. c OmpA gene was cloned in place of nuc gene by using Nsi I and EcoR V RE sites and ligating the digested products.

Techniques: Expressing, Concentration Assay, Staining, Marker

Journal: Indian Journal of Microbiology

Article Title: Factors Affecting Inducible Expression of Outer Membrane Protein A (OmpA) of Shigella dysenteriae Type-1 in Lactococcus lactis Using Nisin Inducible Controlled Expression (NICE)

doi: 10.1007/s12088-015-0556-2

Figure Lengend Snippet: Effect of nisin concentrations, protease inhibitor cocktail and ΔhtrA strain on protein expression. a M ProSieve color protein marker, Lonza Rockland, Lane 1 Uninduced r-NZ9000 (pSEC:OmpA), Lane 2–5 r-NZ9000 (pSEC:OmpA) induced respectively with 2, 5, 10 and 15 ng/ml nisin and protease cocktail. b Lane M-a, M-b Precision plus protein standard, BIORAD, Lane-1 Empty, Lane-2 r-VEL1153 (pSEC:OmpA) induced with 5 ng/mL, Lane-3 r-VEL1153 (pSEC:OmpA) induced at 5 ng/mL with protease cocktail, Lane-4 Uninduced r-VEL1153 (pSEC:OmpA)

Article Snippet: Transformants were screened by colony PCR using ompA specific primers (Forward 5′ GTTTCCTACCGTTTCGGTC 3′ and reverse 5′ TGCGCACTGAGAAGAAGAGA 3′) and verified by restriction sequence analyses. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Fig. 1 caption a7 Expression cassette for outer membrane protein A (OmpA) using the nisin inducible promoter (PnisA) and signal peptide usp45. a OmpA sequence of S. dysenteriae type-1 was commercially synthesized from GenScript in pUC57 cloning vector between Nsi I and EcoR V RE sites. b pSEC:Nuc vector which has a combination of NICE system and usp45 secretory signal was used as a backbone vector. c OmpA gene was cloned in place of nuc gene by using Nsi I and EcoR V RE sites and ligating the digested products.

Techniques: Protease Inhibitor, Expressing, Marker

Journal: Environmental Microbiology

Article Title: The Coral Host Microbiome Modulates the Virulence of the Bacterial Pathogen Vibrio coralliilyticus

doi: 10.1111/1462-2920.70224

Figure Lengend Snippet: Representative photos of diseased M. capitata and a comparison of the orange and red colour morph susceptibility to V. coralliilyticus . Representative photos of (A) a healthy orange M. capitata fragment, (B) the same orange fragment with progressive acute tissue loss, (C) a healthy red fragment, and (D) the same red fragment with progressive acute tissue loss. The black scale bars represent 1.5 cm. Potential differences observed in image clarity between panels A & C and B & D are likely due to dead coral tissue floating in the aquarium water as infection proceeds in panels B & D. (E) Kaplan–Meier survival curve of red and orange M. capitata fragments exposed to V. coralliilyticus OCN008 or OCN014 ( n = 12 for each treatment). The dotted line with open squares represents control orange and red fragments exposed to FSW, A. macleodii OCN004, or V. cyclitrophicus HMSC5 ( n = 12 for each treatment). Black lines with solid circles represent orange fragments exposed to OCN008, grey lines with open circles represent red fragments exposed to OCN008, dashed black lines with solid triangles represent orange fragments exposed to OCN014, and dashed grey lines with open triangles represent red fragments exposed to OCN014.

Article Snippet: AphA and VcpR represent the V. coralliilyticus “low” and “high” cell density quorum sensing regulators (Hasegawa and Häse ; Van Kessel et al. ; Ushijima et al. ; Lydick et al. ), respectively, which suggests that distinct virulence factors may be expressed at different cell densities.

Techniques: Comparison, Infection, Control

Journal: Environmental Microbiology

Article Title: The Coral Host Microbiome Modulates the Virulence of the Bacterial Pathogen Vibrio coralliilyticus

doi: 10.1111/1462-2920.70224

Figure Lengend Snippet: The effect of antibiotic pre‐treatment on M. capitata susceptibility to infection by various V. coralliilyticus strains. Kaplan–Meier survival curves of (A) M. capitata fragments pre‐treated with FSW prior to exposure to six Vibrio strains with control fragments and (B) fragments pre‐treated with ampicillin and spectinomycin before exposure to the same seven treatments. These were paired experiments organised into experimental blocks (i.e., each replicate) consisting of fragments from the same colony (genets) to account for intraspecific differences. The black dotted lines with open squares represent control fragments were exposed to FSW ( n = 10); pink solid lines with closed squares represent fragments exposed to HMSC5 ( n = 10); solid teal likes with closed hexagons represent fragments exposed to H1 ( n = 10); solid purple lines with closed nabla represent fragments exposed to RE22 ( n = 10); solid light blue lines with closed circles represent fragments exposed to BAA‐450 ( n = 10); solid purple lines with closed diamonds represent fragments exposed to RE98 ( n = 10); and solid black lines with closed circles represent fragments exposed to OCN008 ( n = 10). Labels are localised near their represented line on each graph.

Article Snippet: AphA and VcpR represent the V. coralliilyticus “low” and “high” cell density quorum sensing regulators (Hasegawa and Häse ; Van Kessel et al. ; Ushijima et al. ; Lydick et al. ), respectively, which suggests that distinct virulence factors may be expressed at different cell densities.

Techniques: Infection, Control

Journal: Environmental Microbiology

Article Title: The Coral Host Microbiome Modulates the Virulence of the Bacterial Pathogen Vibrio coralliilyticus

doi: 10.1111/1462-2920.70224

Figure Lengend Snippet: Effect of antibiotic pre‐treatment on the virulence of different V. coralliilyticus mutants. Kaplan–Meier survival curves of (A) M. capitata fragments pre‐treated with FSW prior to exposure to OCN008 and OCN014‐derived strains and (B) fragments pre‐treated with ampicillin and spectinomycin before exposure to OCN008 or OCN014‐derived strains. These were paired experiments organised into experimental blocks (i.e., each replicate) consisting of fragments from the same colony (genets) to account for intraspecific differences. Dotted lines with open squares represent controls, which were either exposed to FSW or V. cyclitrophicus HMSC5 ( n = 10 for each treatment). Solid black lines with closed circles represent corals treated with OCN008 ( n = 10). Solid black lines with closed triangles represent corals treated with OCN008 Δ vcpR ( n = 10). Solid black lines with closed diamonds represent corals treated with OCN008 Δ aphA ( n = 10). Dashed blue lines with open circles represent corals treated with OCN014 ( n = 10). Dashed blue lines with open triangles represent corals treated with OCN014 Δ vcpR ( n = 10). Dashed blue lines with open diamonds represent corals treated with OCN014 Δ aphA ( n = 10). Labels are localised near their represented line on each graph.

Article Snippet: AphA and VcpR represent the V. coralliilyticus “low” and “high” cell density quorum sensing regulators (Hasegawa and Häse ; Van Kessel et al. ; Ushijima et al. ; Lydick et al. ), respectively, which suggests that distinct virulence factors may be expressed at different cell densities.

Techniques: Derivative Assay